pET-51b Bacterial Expression Vector
Catalog number :AT1667
The pET-51b(+) vector is designed for cloning and high-level expression of target proteins fused with the 8 aa Strep•Tag II coding sequence that is cleavable with enterokinase (Ek) protease. The plasmid contains a strong T7lac promoter, an optimized RBS, the coding sequence for the Ek protease cleavage site (AspAspAspAspLys), and a multiple cloning site that contains restriction enzyme sites found in many other Novagen expression vectors to facilitate insert transfer. An optional C-terminal His•Tag coding sequence with 10 histidines is compatible with purification, detection, and quantification.
- Overview
- Description
- pET-51b Bacterial Expression Vector
- Properties
Application High-level, inducible(IPTG) expression in Bacterial Bacterial Resistance Ampicillin 5′ sequencing primer T7 Fwd: 5'd[TAATACGACTCACTATAGGG]3' 3′ sequencing primer Promoter T7 promoter Protein Tag His Tag (C-terminal）；Strep TagII (N-terminal） Cloning Method Restriction Enzyme ⁄ MCS Delivery Type Transformation Selection Agent (Eukaryotic) NO Eukaryotic Resistance NO
- Structure Image
- Applications
- Map of Plasmid
- See restriction sites, features, and translations:Sequence Author: Novagen
Related Products
Reviews
loading...
Payments by 
All our products are For Research Use Only. Not for diagnostic or therapeutic usages.