CoIP, ChIP, CUT&RUN, CUT&Tag Expert! My Basket (...)
Worldwide delivery!
Having the Best Alpaca Nanobody Products!
Home | About us | Contact us | How to order |
    My Base Info
    Shopping Basket
    My Orders
    My Shipping Info
    Modify Password
    Log Out

    pGEX-6P1 Bacterial Expression Vector

    Catalog number :AT1664
    loading...
    Bacterial vector for expressing GST fusion proteins with a PreScission protease site.
    Overview
    Description
    pGEX-6P-1 Bacterial Expression Vector
    Properties
    Form
    5 µg vector supplied in 10 mM Tris, 1 mM EDTA pH 8.0. 
    Application High-level, inducible expression in Bacterial
    Bacterial Resistance Ampicillin
    5′ sequencing primer pGEX5':  GGGCTGGCAAGCCACGTTTGGTG
    3′ sequencing primer pGEX3': CCGGGAGCTGCATGTGTCAGAGG
    Promoter tac promoter
    Protein Tag an N-terminal GST tag
    Cloning Method Restriction Enzyme ⁄ MCS
    Delivery Type Transformation
    Selection Agent (Eukaryotic) NO
    Eukaryotic Resistance NO

    Structure Image
    Applications
    Map of Plasmid
    See restriction sites, features, and translations:
     
    Sequence Author:  GE Healthcare

    Related Products

    Reviews

    loading...
    Content *:
    Customer Review :
    Verification Code * :
    refresh image

    Shipping and Paying Info
    ......
    Order Information
    You can place an order online step by step as blow.

    Step 1. Register for a new account and Log in, Find out your product by searching our website.
    Step 2. Add the Product into your shopping basket, select your settlement currency.
    Step 3. Checkout by Paypal, Pay by credit card or bank transfer for your order.
    Step 4. Ship the goods for you, providing you package tracking numbers. 

    Any questions, please contact us via email: sale@engibodybio.com
    Payments by
    All our products are For Research Use Only. Not for diagnostic or therapeutic usages.